hypothesis
hypothesis
Instruction
Instruction
The National Organization of Nurse Practitioner Faculties (NONPF) has determined core competencies that apply to all nurse practitioners, regardless of specialty or patient population focus. NONPF has represented them within nine broad areas of core competence. NONPF created the first set of Nurse Practitioner Competencies in 1990; the most recent updates were incorporated in 2017. This synthesis course has had the overarching objective of preparing you to be able to synthesize knowledge gained throughout the program and be prepared to apply each of the nine core competencies within your selected areas of practice and your representative communities.
The nine broad areas of competency are:
To Prepare:
The Assignment
For each of the nine NONPF competencies, write one paragraph explaining how the program has prepared you to meet it (for a total of at least nine paragraphs). Then, propose and explain how you plan to engage in social change in your community as a nurse practitioner. Be specific and provide examples.
Instruction
UNIVERSITY OF KENT
DIVISION OF COMPUTING, ENGINEERING
AND MATHEMATICAL SCIENCES
LEVEL 6 EXAMINATION
Computational Intelligence in Business, Economics & Finance
Paper Instructions
The paper contains TWO questions. Answer ALL the questions.
Notes to Candidates
This examination is designed to take two hours but you can take longer if you
wish. Please ensure that you submit your answer booklet within 24 hours of the
exam release time.
As you will have access to resources to complete your assessment, any content
you use from external source materials should be cited. Full academic referencing
is not required.
You are reminded of your responsibility to act with honesty, integrity and fairness
in completing assessment requirements for your course, and to demonstrate good
academic practice when undertaking this assessment.
This is an individual piece of work and collusion with others is strictly prohibited.
Plagiarism detection software will be in use.
Breaches of academic integrity will be considered to be academic misconduct.
Where the University believes that academic misconduct has taken place the
University will investigate the case and apply academic penalties as published in
Annex 10 of the Credit Framework.
– 2 –
1. (a) For each of the statements below, say whether it is true or false, and briefly
justify your answer.
(i) The selection method in a Genetic Algorithm can be used to control
the exploration and exploitation properties of the search.
[3 marks]
(ii) Performing a crossover between 2 identical individuals will result in
different offspring.
[3 marks]
(iii) The best individual fitness value of a generation can be lower than the
previous generation.
[3 marks]
(iv) The individual selected as a winner in a tournament selection is
chosen at random.
[3 marks]
(v) Genetic Algorithms guarantee finding the optimal solution for a given
problem.
[3 marks]
(b) Given the following 2 individuals of a Genetic Programming population:
Individual 1 Individual 2
where the data types of each function and terminal nodes are:
input data type output data type
AND, OR (boolean, boolean) boolean
>, < (real, real) boolean
+, −, , (real, real) real
a, b, 5, 7, 10 – real
(i) Perform a subtree crossover between Individuals 1 and 2, showing
the resulting offspring (2 individuals).
[8 marks]
– 3 –
(ii) Perform a subtree mutation on Individual 1 using the node ‘<’ as the
mutation point, showing the resulting offspring (1 individual).
[4 marks]
(iii) Create a new individual using a full initialisation method and a
maximum tree depth of 3.
[3 marks]
– 4 –
2. (a) Consider the problem of finding the shortest path in a city map starting
from a point A and terminating at a point B. Is this a travelling
salesman problem (TSP)? Justify your answer, also referring to the
computational complexity of the problem.
[6 marks]
(b) (i) Consider the following 5-city TSP problem illustrated in Figure A. The
edges of the graph correspond to the distance between the cities. What is the
cost of the dashed tour (i.e. the tour 1-2-3-4-5-1)?
[2 marks]
Figure A
(ii) Is there any better solution (tour) to improve the cost calculated in (i)?
Indicate the tour, the cost and justify why this is a better solution with
respect to the previous tour.
[4 marks]
(c) (i) Consider the following 5-city TSP problem illustrated in Figure B. The
edges of the graph correspond to the distance between the cities. Explain what
are the main differences compared to the TSP problem presented in Figure A?
[2 marks]
Figure B
3 2
4 5
2
2
1
1
1
1
1
1
2
6
3 2
4 5
2
6
1
1
1
1
1
1
2
– 5 –
(ii) Write a viable tour and its related cost for the TSP problem in Figure B.
[4 marks]
(d) (i) Consider a Genetic Algorithm implementation to solve a TSP problem. Is
the binary representation a good choice for the individual representation?
Justify your answer.
[3 marks]
(ii) Provide an example of an individual representation for the tour illustrated
in Figure A (tour 1-2-3-4-5-1). Justify your choice of representation.
[4 marks]
(iii) Describe a suitable mutation operator and apply mutation to the
individual from (ii).
[5 marks]
Where would you expect to find aliphatic amino acids in a soluble protein in an aqueous environment? What force drives this behavior? Can you provide a scenario in which they could have a different location for these amino acids?
Both beta-turns and gamma-turns often contain glycines and prolines respectively. Why do you think this is so?
What is the post translational modification being depicted in the attached link? On which residues does it occur? Which family of enzymes mediate its addition? Which family of enzymes mediate its removal? Discuss the functions of this form of post-translational modification.
Describe the theoretical basis of affinity chromatography? Antibodies are readily purified using this form of chromatography by exploiting the activities of Protein A and Protein G Staphylococcus Aureus. Why is this possible? What region of the antibody is important in this process? Is this a universal process for different antibodies and if so why?
Tryptic enzymatic digestion is often used in mass spectrometry. Given you know that trypsin cleaves after Lys or Arg, how do you think this can help you detect and identify proteins you are analysing from a known biological source? For example a human sample.
What properties of DNA allow it to act as a heritable molecule?
Discuss the structure and function of RNA polymerase?
Discuss the differences in protein translation in prokaryotes and in eukaryotes.
Given the following prokaryote sequence of DNA:
Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence)
Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).
Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table).
Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)
5’TGGCCCCTTTCATTGACACCACAATCACATCTCTACGTATAAGCGCTTAGGTCCTCTTGGAGGGTTTCGCATGGTTATCATATCTCCCACCCGCCGCTTTAGGCTAAGACCTAAGTGATGGACTTTCGATC 3’
Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence)
Predict the mRNA sequence that would arise from this DNA sequence.
Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).
Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table).
Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)
5’TGGCCCCTTTCATTGACACCACAATCACATCTCTACGTATAAGCGCTTAGGTCCTCTTGGAGGGTTTCGCATGGTTATCATATCTCCCACCCGCCGCTTTAGGCTAAGACCTAAGTGATGGACTTTCGATC 3’
Why do different religious rooms look the way they do? Why are there so many pictures in most sacred buildings? Why are so many churches and temples so large, and how has it been possible to build so large?
How do you think the sacred rooms have affected people and their faith? How do Christian churches differ from sacred spaces in other religions?
Your rites of passage What rites of passage have you experienced yourself, and do you think you will experience? What do they mean to you?
-____________________________________________________________________________________________The world religions
Answer the questions :
Study the compilation of the five world religions.
Select two religions, or two phenomena such as the attributes of God or the Holy Scriptures, and compare them in a Venn chart.
(A Venn diagram is two (or more) circles that describe what two phenomena have in common and what properties are only present in one or the other. Feel free to google image if you want more inspiration.)
Choose another religion, or a different phenomenon, and see if you can get larger or smaller deviations in the Venn diagram. So you should make two different Venn diagrams.
Assessment 2 Instructions: Interview and Interdisciplinary Issue Identification
Top of Form
Bottom of Form
As a baccalaureate-prepared nurse, your participation and leadership in interdisciplinary teams will be vital to the health outcomes for your patients and organization. One way to approach designing an improvement project is to use the Plan-Do-Study-Act (PDSA) cycle. The Institute for Healthcare Improvement describes it thus:
The Plan-Do-Study-Act (PDSA) cycle is shorthand for testing a change in the real work setting—by planning it, trying it, observing the results, and acting on what is learned. This is the scientific method adapted for action-oriented learning…Essentially, the PDSA cycle helps you test out change ideas on a smaller scale before evaluating the results and making adjustments before potentially launching into a somewhat larger scale project (n.d.).
You might also recognize that the PDSA cycle resembles the nursing process. The benefit of gaining experience with this model of project design is that it provides nurses with an opportunity to ideate and lead improvements. For this assessment, you will not be implementing all of the PDSA cycle. Instead, you are being asked to interview a health care professional of your choice to determine what kind of interdisciplinary problem he or she is experiencing or has experienced in the workplace. This interview, in Assessment 2, will inform the research that you will conduct to propose a plan for interdisciplinary collaboration in Assessment 3.
It would be an excellent choice to complete the PDSA Cycle activity prior to developing the report. The activity consists of four questions that create the opportunity to check your understanding of best practices related to each stage of the PDSA cycle. The information gained from completing this formative will promote your success with the Interview and Interdisciplinary Issue Identification report. This will take just a few minutes of your time and is not graded.
Reference
Institute for Healthcare Improvement. (n.d.). How to improve. http://www.ihi.org/resources/Pages/HowtoImprove/default.aspx
Demonstration of Proficiency
Professional Context
This assessment will introduce the Plan-Do-Study-Act (PDSA) Model to create change in an organization. By interviewing a colleague of your choice, you will begin gathering information about an interprofessional collaboration problem that your colleague is experiencing or has experienced. You will identify a change theory and leadership strategies to help solve this problem.
Scenario
This assessment is the first of three related assessments in which you will gather interview information (Assessment 2); design a proposal for interdisciplinary problem-solving, (Assessment 3); and report on how an interdisciplinary improvement plan could be implemented in a place of practice (Assessment 4). At the end of the course, your interviewee will have a proposal plan based on the PDSA cycle that he or she could present to stakeholders to address an interdisciplinary problem in the workplace.
For this assessment, you will need to interview a health care professional such as a fellow learner, nursing colleague, administrator, business partner, or another appropriate person who could provide you with sufficient information regarding an organizational problem that he or she is experiencing or has experienced, or an area where they are seeking improvements. Consult the Interview Guide [DOCX] for an outline of how to prepare and the types of information you will need to complete this project successfully.
Remember: this is just the first in a series of three assessments.
Instructions
For this assessment, you will report on the information that you collected in your interview, analyzing the interview data and identifying a past or current issue that would benefit from an interdisciplinary approach. This could be an issue that has not been addressed by an interdisciplinary approach or one that could benefit from improvements related to the interdisciplinary approach currently being used. You will discuss the interview strategy that you used to collect information. Your interview strategy should be supported by citations from the literature. Additionally, you will start laying the foundation for your Interdisciplinary Plan Proposal (Assessment 3) by researching potential change theories, leadership strategies, and collaboration approaches that could be relevant to issue you have identified. Please be certain to review the scoring guide to confirm specific required elements of this assessment. Note that there are differences between basic, proficient and distinguished scores.
When submitting your plan, use the Interview and Issue Identification Template [DOCX], which will help you to stay organized and concise. As you complete the template, make sure you use APA format for in-text citations for the evidence and best practices that are informing your plan, as well as for the reference list at the end.
Additionally, be sure to address the following, which corresponds to the grading criteria in the scoring guide. Please study the scoring guide carefully so you understand what is needed for a distinguished score.
Additional Requirements
Portfolio Prompt: Remember to save the final assessment to your ePortfolio so that you may refer to it as you complete the final Capstone course.
Use the scoring guide to understand how your assessment will be evaluated.
This is for research paper purposes. The analysis most include the following:
Regression , cronbach alpha Multi regression. Multi group analysis. P Value
Identify and discuss what type of laws (both civil and criminal) are most fraudsters charged with as a result of a fraud investigation. What similarities and differences do you see between civil and criminal laws relating to fraud cases? Be sure to include specific examples to back up your conclusions.
Please write one page and half
Q1. Please read the below paragraph and write your opinion.
Note: 150 words with intext citation and references please.
There are many different factors when we are trying to evaluate an information project. The most important factor is aligned with All Stakeholders. The goal of an information project is that we are set up to deal with certain problems. The whole system is used to solve these questions. So, aligning with all the stakeholders is the key to the evaluation. If you cannot pass the evaluation from the stakeholders, the project will never work.
There are huge differences between short and long solutions. One biggest factor is the scope. The scope defines the overall requirements and rules. Both short and long solutions have a scope.
Every project needs an evaluation. Basically, the evaluation belongs to the testing process in the SDLC. In this process, the deficits of the project will be revealed. In the future, people in the project can update and modify their project according to the evaluation.
Q2. Please read the below paragraph and write your opinion.
Note: 150 words with intext citation and references please.
*SMART RESTAURANT SYSTEM*
1: To apply this project we need to change the interface of restaurant since we need the conveyor belts for delivering food on the tables. This will cause a increase in cost but same time we would not need the man power (Where we can save money).
2: Customer can only place an order when inside the restaurant. Order will be delayed if Conveyer belt gets jammed.
3: Order will be placed by the customer through a touch panel.
– Order that is ready will be served to the customer through a conveyor belt.
– The expense of the waiter will be greatly reduced.
– An invoice for all the orders placed by the customer will be generated at run time.
– New menus will not be required to be printed.
Myassignmentshelpers exists to ease challenging concepts for students. Any paper from our distinguished tutors should only be used for academic referencing and learning purposes—none of them should be submitted as they are. Once sold out,Myassignmentshelpers shall not be liable for any misuse of the papers—either plagiarism, wrong citation, among others.
support@myassignmentshelpers.com
Phone Number
+1 (289) 803-6873