material in Proteins and DNA

Where would you expect to find aliphatic amino acids in a soluble protein in an aqueous environment? What force drives this behavior? Can you provide a scenario in which they could have a different location for these amino acids?

Both beta-turns and gamma-turns often contain glycines and prolines respectively. Why do you think this is so?

What is the post translational modification being depicted in the attached link? On which residues does it occur? Which family of enzymes mediate its addition? Which family of enzymes mediate its removal? Discuss the functions of this form of post-translational modification.

Describe the theoretical basis of affinity chromatography? Antibodies are readily purified using this form of chromatography by exploiting the activities of Protein A and Protein G Staphylococcus Aureus. Why is this possible? What region of the antibody is important in this process? Is this a universal process for different antibodies and if so why?

Tryptic enzymatic digestion is often used in mass spectrometry. Given you know that trypsin cleaves after Lys or Arg, how do you think this can help you detect and identify proteins you are analysing from a known biological source? For example a human sample.

Enzymes are known as biological catalysts. Explain what you understand about this term.

What properties of DNA allow it to act as a heritable molecule?

Discuss the structure and function of RNA polymerase?

Discuss the differences in protein translation in prokaryotes and in eukaryotes.

Given the following prokaryote sequence of DNA:

Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence)

Predict the mRNA sequence that would arise from this DNA sequence.

Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).

Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table).

Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)

5’TGGCCCCTTTCATTGACACCACAATCACATCTCTACGTATAAGCGCTTAGGTCCTCTTGGAGGGTTTCGCATGGTTATCATATCTCCCACCCGCCGCTTTAGGCTAAGACCTAAGTGATGGACTTTCGATC 3’