material in Proteins and DNA

 

Where would you expect to find aliphatic amino acids in a soluble protein in an aqueous environment? What force drives this behavior? Can you provide a scenario in which they could have a different location for these amino acids?

Both beta-turns and gamma-turns often contain glycines and prolines respectively. Why do you think this is so?

What is the post translational modification being depicted in the attached link? On which residues does it occur? Which family of enzymes mediate its addition? Which family of enzymes mediate its removal? Discuss the functions of this form of post-translational modification.

 

Describe the theoretical basis of affinity chromatography? Antibodies are readily purified using this form of chromatography by exploiting the activities of Protein A and Protein G Staphylococcus Aureus. Why is this possible? What region of the antibody is important in this process? Is this a universal process for different antibodies and if so why?

 

Tryptic enzymatic digestion is often used in mass spectrometry. Given you know that trypsin cleaves after Lys or Arg, how do you think this can help you detect and identify proteins you are analysing from a known biological source? For example a human sample.

 Enzymes are known as biological catalysts. Explain what you understand about this term.

What properties of DNA allow it to act as a heritable molecule?

Discuss the structure and function of RNA polymerase?

Discuss the differences in protein translation in prokaryotes and in eukaryotes.

Given the following prokaryote sequence of DNA:

Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence)

Predict the mRNA sequence that would arise from this DNA sequence.

Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).

Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table).

Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)

5’TGGCCCCTTTCATTGACACCACAATCACATCTCTACGTATAAGCGCTTAGGTCCTCTTGGAGGGTTTCGCATGGTTATCATATCTCCCACCCGCCGCTTTAGGCTAAGACCTAAGTGATGGACTTTCGATC 3’

 

 Given the following prokaryote sequence of DNA:

Identify if any promoter sequences are present in DNA SEQ1 (Highlight/Underline these in the sequence)

Predict the mRNA sequence that would arise from this DNA sequence.

Identify the ribosome binding site, start and stop codons (if present). (Highlight/Underline these in the sequence).

Predict the sequence of the peptide that would arise from the predicted mRNA sequence using the genetic code table (see Codon usage table).

Based on your knowledge of the properties of amino acids speculate on the properties of the predicted peptide (e.g. charge, hydrophobicity, aromaticity)

5’TGGCCCCTTTCATTGACACCACAATCACATCTCTACGTATAAGCGCTTAGGTCCTCTTGGAGGGTTTCGCATGGTTATCATATCTCCCACCCGCCGCTTTAGGCTAAGACCTAAGTGATGGACTTTCGATC 3’

 

Interview and Interdisciplinary Issue Identification nursing

Assessment 2 Instructions: Interview and Interdisciplinary Issue Identification

Top of Form

Bottom of Form

• PRINT
• For this assessment, you will create a 3 page report on an interview you have conducted with a health care professional. You will identify an issue from the interview that could be improved with an interdisciplinary approach, and review best practices and evidence to address the issue.

As a baccalaureate-prepared nurse, your participation and leadership in interdisciplinary teams will be vital to the health outcomes for your patients and organization. One way to approach designing an improvement project is to use the Plan-Do-Study-Act (PDSA) cycle. The Institute for Healthcare Improvement describes it thus:

The Plan-Do-Study-Act (PDSA) cycle is shorthand for testing a change in the real work setting—by planning it, trying it, observing the results, and acting on what is learned. This is the scientific method adapted for action-oriented learning…Essentially, the PDSA cycle helps you test out change ideas on a smaller scale before evaluating the results and making adjustments before potentially launching into a somewhat larger scale project (n.d.).

You might also recognize that the PDSA cycle resembles the nursing process. The benefit of gaining experience with this model of project design is that it provides nurses with an opportunity to ideate and lead improvements. For this assessment, you will not be implementing all of the PDSA cycle. Instead, you are being asked to interview a health care professional of your choice to determine what kind of interdisciplinary problem he or she is experiencing or has experienced in the workplace. This interview, in Assessment 2, will inform the research that you will conduct to propose a plan for interdisciplinary collaboration in Assessment 3.

It would be an excellent choice to complete the PDSA Cycle activity prior to developing the report. The activity consists of four questions that create the opportunity to check your understanding of best practices related to each stage of the PDSA cycle. The information gained from completing this formative will promote your success with the Interview and Interdisciplinary Issue Identification report. This will take just a few minutes of your time and is not graded.

Reference

Institute for Healthcare Improvement. (n.d.). How to improve. http://www.ihi.org/resources/Pages/HowtoImprove/default.aspx

Demonstration of Proficiency

• • Competency 2: Explain how interdisciplinary collaboration can be used to achieve desired patient and systems outcomes.

• • • Summarize an interview focused on past or current issues at a health care organization.
    • Describe collaboration approaches from the literature that could be relevant in establishing or improving an interdisciplinary team to address an organizational issue.
  • Competency 3: Describe ways to incorporate evidence-based practice within an interdisciplinary team.

• • • Identify an issue from an interview for which an evidence-based interdisciplinary approach would be appropriate.
  • Competency 4: Explain how change management theories and leadership strategies can enable interdisciplinary teams to achieve specific organizational goals.

• • • Describe change theories and a leadership strategy that could help develop an interdisciplinary solution to an organizational issue.
  • Competency 5: Apply professional, scholarly, evidence-based communication strategies to impact patient, interdisciplinary team, and systems outcomes.

• • • Organize content so ideas flow logically with smooth transitions; contains few errors in grammar/punctuation, word choice, and spelling.
    • Apply APA formatting to in-text citations and references, exhibiting nearly flawless adherence to APA format.

Professional Context

This assessment will introduce the Plan-Do-Study-Act (PDSA) Model to create change in an organization. By interviewing a colleague of your choice, you will begin gathering information about an interprofessional collaboration problem that your colleague is experiencing or has experienced. You will identify a change theory and leadership strategies to help solve this problem.

Scenario

This assessment is the first of three related assessments in which you will gather interview information (Assessment 2); design a proposal for interdisciplinary problem-solving, (Assessment 3); and report on how an interdisciplinary improvement plan could be implemented in a place of practice (Assessment 4). At the end of the course, your interviewee will have a proposal plan based on the PDSA cycle that he or she could present to stakeholders to address an interdisciplinary problem in the workplace.

For this assessment, you will need to interview a health care professional such as a fellow learner, nursing colleague, administrator, business partner, or another appropriate person who could provide you with sufficient information regarding an organizational problem that he or she is experiencing or has experienced, or an area where they are seeking improvements. Consult the Interview Guide [DOCX] for an outline of how to prepare and the types of information you will need to complete this project successfully.

Remember: this is just the first in a series of three assessments.

Instructions

For this assessment, you will report on the information that you collected in your interview, analyzing the interview data and identifying a past or current issue that would benefit from an interdisciplinary approach. This could be an issue that has not been addressed by an interdisciplinary approach or one that could benefit from improvements related to the interdisciplinary approach currently being used. You will discuss the interview strategy that you used to collect information. Your interview strategy should be supported by citations from the literature. Additionally, you will start laying the foundation for your Interdisciplinary Plan Proposal (Assessment 3) by researching potential change theories, leadership strategies, and collaboration approaches that could be relevant to issue you have identified. Please be certain to review the scoring guide to confirm specific required elements of this assessment. Note that there are differences between basic, proficient and distinguished scores.

When submitting your plan, use the Interview and Issue Identification Template [DOCX], which will help you to stay organized and concise. As you complete the template, make sure you use APA format for in-text citations for the evidence and best practices that are informing your plan, as well as for the reference list at the end.

Additionally, be sure to address the following, which corresponds to the grading criteria in the scoring guide. Please study the scoring guide carefully so you understand what is needed for a distinguished score.

• • Summarize an interview focused on past or current issues at a health care organization.
  • Identify an issue from an interview for which an evidence-based interdisciplinary approach would be appropriate.
  • Describe potential change theories and leadership strategies that could inform an interdisciplinary solution to an organizational issue.
  • Describe collaboration approaches from the literature that could facilitate establishing or improving an interdisciplinary team to address an organizational issue.
  • Communicate with writing that is clear, logically organized, and professional, with correct grammar and spelling, and using current APA style.

Additional Requirements

• • Length of submission: Use the provided template. Most submissions will be 3 pages in length. Be sure to include a reference page at the end of the plan.
  • Number of references: Cite a minimum of 3 sources of scholarly or professional evidence that support your central ideas. Resources should be no more than 5 years old.
  • APA formatting: Make sure that in-text citations and reference list follow current APA style.

Portfolio Prompt: Remember to save the final assessment to your ePortfolio so that you may refer to it as you complete the final Capstone course.

• SCORING GUIDE

Use the scoring guide to understand how your assessment will be evaluated.

VIEW SCORING GUIDE

 

civil and criminal laws

Identify and discuss what type of laws (both civil and criminal) are most fraudsters charged with as a result of a fraud investigation. What similarities and differences do you see between civil and criminal laws relating to fraud cases? Be sure to include specific examples to back up your conclusions.

Please write one page and half

leadership

Module 1

Module 1 – Lecture Notes and Discussion Questions

Module One

            Discussion topics include:

1. What is leadership?
2. Leadership myths
3. The leader-follower-situation triad

Assignments for Session 1 include:

1. Text: Chapter 1

As you read Chapter 1, you will see that there have been many definitions offered for the common word “leadership.”  Leadership is influence.  In this broad sense, we are all leaders in many aspects of our lives and with many people.  Parents influence children; friends influence friends; colleagues influence colleagues.  Subordinates influence their bosses as sure as bosses influence their subordinates.  Leadership opportunities are everywhere.

I have always been curious as to how leadership can be both an art and a science, although I am sure it is a combination of both.  “Art” seems to imply a creativity and an essential lack of order while “science” seems to be very much the opposite. Science rests on research and, as you will learn through your master’s curriculum in leadership, much research has been done in this field.  Yet, great leaders often know nothing about this research and seem not to ascribe to any scientific application of principles emanating from that research.  What makes a great leader in any event?

Leadership entails an essential interaction between at least three elements: the leader, the followers, and the situation.  Depending on the particulars of these elements, a “great leader” in one situation may be quite ineffective in another situation.  To understand leadership, then, it is probably important to equally concentrate on situations and followers.

Module One Discussion Questions

Note: Please type the question and then the answer which should be about 250 words for each question.

1. Describe the best leader you have personally known. What makes this person such a good leader?  Include in your description the characteristics detailed in the textbook.  How does your leader exhibit some of these characteristics?

 

1. What are the essential differences between being an effective manager and an effective leader?

 

Module 2

– Lecture Notes and Discussion Questions

Module Two

Discussion topics include:
1.     Leader development
2.     Skills for Developing Yourself as a Leader
3.     Building effective relationships

Assignments for Session 2 include:
1.     Text: Chapters 2-3

The topics this week include leadership development, skills development and building effective relationships. Read chapters 2-3 carefully.  If we accept the fact that not all leaders are “born,” then we need to know something about how leadership can be developed.  What can individuals and organizations do to ensure that they have the leadership talent which is needed given the leader—follower—situation triad?

Underlining my personal belief in the efficacy of leadership development through experience, each student in the class is being given the opportunity to experientially develop two leadership skills as part of the course. These are the leadership experiences which you will be documenting as part of your assignments and the requirements are clearly outlined in the syllabus. If you haven’t begun working on your first experiential exercise, the leadership skill, you need to get started this week.

Leadership development can also be done through education and training.  University courses such as this would fall into this category.   Corporations also spend a great deal of time and money designing leadership development programs.  Some of these programs are contracted to organizations such as the Center for Leadership Development in Escondido, California, home of Paul Hersey and Situational Leadership.  Each year, people from all over the world are trained in the Situational Leadership model and coached in how to apply it within their organizations.  Other programs like adventure learning promise leadership training from a different angle. You only have to search “adventure learning” and “leadership” in Google to see how many companies now provide off-site, wilderness and other types of learning experiences for corporations.
And yet another effective way to develop leaders is through mentoring programs.

Do these programs work?  Assessing leadership is a complicated topic which is the focus of Chapter 4.  Measuring the effects of that leadership goes still further.

Module Two Discussion Questions

Note: Please type the question and then the answer which should be about 250 words for each question.

1.    Which Leadership Skill have you chosen for your Skill Building Assignment?  Tell us why you have made this choice and what your plans are to improve in this skill area.
2.    If you were to design the perfect leadership development experience for yourself, how would you do so and what would it include?  How would you know whether it was effective?

 

 

Welfare – the never-ending debate

https://www.youtube.com/watch?v=t_ssxCKpECY&t=1s.  link to video

During the video – the speaker discusses “Welfare – the never-ending debate”. In an essay format paper, discuss/answer the questions he asks (list the question and reply with a minimum of a few paragraphs):

How should government promote “the general welfare”?

What welfare programs should exist?

Who should benefit?

What role should the federal government play relative to the states?

Is it a government role at all?